The size of VNTR varies in size from 0.1 to20 kb as the numbers of repeats show very high degree of polymorphism. How can VNTR probes detect VNTRs of different people if there is so much variation in size?

see full answer

Start JEE / NEET / Foundation preparation at rupees 99/day !!

21% of IItians & 23% of AIIMS delhi doctors are from Sri Chaitanya institute !!

An Intiative by Sri Chaitanya

All samples are tested with the largest possible probe

The probe is digested by enzymes in order to get different sizes.

All the VNTRs at the same locus contain the same repeat sequence (variable number of times), and so we need only one probe

We use probes of different lengths to test the samples of different people.

answer is A.

(Unlock A.I Detailed Solution for FREE)

Ready to Test Your Skills?

Check your Performance Today with our Free Mock Test used by Toppers!

Take Free Test

Detailed Solution

VNTRs are varying repeats at a specific location. VNTR probes are specific to the sequence of the repeats, not the size. So, a single probe with a single VNTR sequence is sufficient. It can bind to VNTRs of different lengths because all these contain at least one copy of the VNTR repeat sequence.

For example: if the repeat sequence is ATGCG,

VNTR of person A can be ATGCGATGCGATGCGATGCG (4 repeats)

VNTR of person B can be ATGCGATGCGATGCGATGCGATGCGATGCG (6 repeats)

A probe TACGC can bind to either of the above VNTRs.

Watch 3-min video & get full concept clarity

Result Producing online coaching for JEE/NEET of south India

Largest All India Test Series for JEE/NEET

Best Books for IIT JEE

Best Books for NEET

How to Join IIT after 10th