The size of VNTR varies in size from 0.1 to20 kb as the numbers of repeats show very high degree of polymorphism. How can VNTR probes detect VNTRs of different people if there is so much variation in size?

see full answer

Your Exam Success, Personally Taken Care Of

1:1 expert mentors customize learning to your strength and weaknesses – so you score higher in school , IIT JEE and NEET entrance exams.

An Intiative by Sri Chaitanya

All the VNTRs at the same locus contain the same repeat sequence (variable number of times), and so we need only one probe

We use probes of different lengths to test the samples of different people.

All samples are tested with the largest possible probe

The probe is digested by enzymes in order to get different sizes.

answer is A.

(Unlock A.I Detailed Solution for FREE)

Best Courses for You

JEE

NEET

Foundation JEE

Foundation NEET

CBSE

Detailed Solution

VNTRs are varying repeats at a specific location. VNTR probes are specific to the sequence of the repeats, not the size. So, a single probe with a single VNTR sequence is sufficient. It can bind to VNTRs of different lengths because all these contain at least one copy of the VNTR repeat sequence.

For example: if the repeat sequence is ATGCG,

VNTR of person A can be ATGCGATGCGATGCGATGCG (4 repeats)

VNTR of person B can be ATGCGATGCGATGCGATGCGATGCGATGCG (6 repeats)

A probe TACGC can bind to either of the above VNTRs.

Watch 3-min video & get full concept clarity