Book Online Demo
Check Your IQ
Try Test

Courses

Dropper NEET CourseDropper JEE CourseClass - 12 NEET CourseClass - 12 JEE CourseClass - 11 NEET CourseClass - 11 JEE CourseClass - 10 Foundation NEET CourseClass - 10 Foundation JEE CourseClass - 10 CBSE CourseClass - 9 Foundation NEET CourseClass - 9 Foundation JEE CourseClass -9 CBSE CourseClass - 8 CBSE CourseClass - 7 CBSE CourseClass - 6 CBSE Course

Q.

 Which of the following mRNA will get translated completely?

see full answer

Start JEE / NEET / Foundation preparation at rupees 99/day !!

21% of IItians & 23% of AIIMS delhi doctors are from Sri Chaitanya institute !!
An Intiative by Sri Chaitanya

a

AUGUUUCCUAUUAGGGUGUU

b

GUGUUUCCUCAUGGUUGAGUU

c

AUGUUUCCUCAUGGUGUUUAA

d

AUGUUUCCUUGAAUGGUUUUA

answer is C.

(Unlock A.I Detailed Solution for FREE)

Ready to Test Your Skills?

Check your Performance Today with our Free Mock Test used by Toppers!

Take Free Test

Detailed Solution

The mRNA sequence AUGUUUCCUCAUGGUGUUUAA will be completely translated. This is because it starts with a start codon AUG and the stop codon is located at the end of the mRNA sequence. In all the other cases the stop codon is located in between the sequence and hence the entire mRNA cannot be translated.

Watch 3-min video & get full concept clarity
Related Blogs
Get ₹ 1 crore* worth scholarship for JEE / NEET / Foundation
Result Producing online coaching for JEE/NEET of south India
Largest All India Test Series for JEE/NEET
Best Books for IIT JEE
Best Books for NEET
How to Join IIT after 10th
score_test_img

Get Expert Academic Guidance – Connect with a Counselor Today!

Related Blogs
Get ₹ 1 crore* worth scholarship for JEE / NEET / Foundation
Result Producing online coaching for JEE/NEET of south India
Largest All India Test Series for JEE/NEET
Best Books for IIT JEE
Best Books for NEET
How to Join IIT after 10th
whats app icon
 Which of the following mRNA will get translated completely?