Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?

The strand that has the polarity 3’-5’ acts as a template, and it is also referred to as template strand. The other strand, which has the polarity (5’-3’) and the sequence same as RNA (except thymine at the place of uracil), is referred to as coding strand. So if the sequence on mRNA is 5’ AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3’,
the sequence on coding strand would be 5’ ATCGATCGATCGATCGATCGATCGATCG 3’.
(1) In the sequence 3’ ATCGATCGATCGATCG ATCGATCGATCG 5’, the polarity is not correct.
(2) In the sequence 5’ UAGCUAGCUAGC UAGCUAGCUAGCUAGC 3‘, uracil is present; but uracil is never present in the DNA. Hence, it cannot be the sequence of the coding strand.
(3) In the sequence 3’ AGCUAGCUAGCUA GCUAGCUAGCUAGC 5’, uracil is present; but uracil is never present in the DNA. Hence, it cannot be the sequence of the coding strand.