Questions
Which of the following mRNA will get translated completely?
detailed solution
Correct option is C
The mRNA sequence AUGUUUCCUCAUGGUGUUUAA will be completely translated. This is because it starts with a start codon AUG and the stop codon is located at the end of the mRNA sequence. In all the other cases the stop codon is located in between the sequence and hence the entire mRNA cannot be translated.Talk to our academic expert!
Similar Questions
The process of polymerisation of amino acids to form a polypeptide is
799 666 8865
support@infinitylearn.com
6th Floor, NCC Building, Durgamma Cheruvu Road, Vittal Rao Nagar, HITEC City, Hyderabad, Telangana 500081.
JEE Mock Tests
JEE study guide
JEE Revision Notes
JEE Important Questions
JEE Sample Papers
JEE Previous Year's Papers
NEET previous year’s papers
NEET important questions
NEET sample papers
NEET revision notes
NEET study guide
NEET mock tests