First slide
Translation
Question

 Which of the following mRNA will get translated completely?

Moderate
Solution

The mRNA sequence AUGUUUCCUCAUGGUGUUUAA will be completely translated. This is because it starts with a start codon AUG and the stop codon is located at the end of the mRNA sequence. In all the other cases the stop codon is located in between the sequence and hence the entire mRNA cannot be translated.

Get Instant Solutions
When in doubt download our app. Now available Google Play Store- Doubts App
Download Now
Doubts App